Display options
Cite
Somers DE, Caspar T, Quail PH. Isolation and Characterization of a Ferredoxin Gene from Arabidopsis thaliana. Plant Physiol. 1990;93(2):572-7doi: 10.1104/pp.93.2.572.
Somers, D. E., Caspar, T., & Quail, P. H. (1990). Isolation and Characterization of a Ferredoxin Gene from Arabidopsis thaliana. Plant physiology, 93(2), 572-7. https://doi.org/10.1104/pp.93.2.572
Somers, D E, et al. "Isolation and Characterization of a Ferredoxin Gene from Arabidopsis thaliana." Plant physiology vol. 93,2 (1990): 572-7. doi: https://doi.org/10.1104/pp.93.2.572
Somers DE, Caspar T, Quail PH. Isolation and Characterization of a Ferredoxin Gene from Arabidopsis thaliana. Plant Physiol. 1990 Jun;93(2):572-7. doi: 10.1104/pp.93.2.572. PMID: 16667505; PMCID: PMC1062552.
Copy Download .nbib Format: NLM
Share it on

Plant Physiol. 1990 Jun;93(2):572-7. doi: 10.1104/pp.93.2.572.

Isolation and Characterization of a Ferredoxin Gene from Arabidopsis thaliana.

Plant physiology

D E Somers, T Caspar, P H Quail

Affiliations

  1. Department of Plant Biology, University of California, Berkeley, California 94720.

PMID: 16667505 PMCID: PMC1062552 DOI: 10.1104/pp.93.2.572

Abstract

We report the cloning and characterization of an Arabidopsis thaliana (L.) Heynh. (Columbia ecotype) ferredoxin gene (Fed A). Sequence analysis of a genomic clone shows an intron-free, 444-base pair open reading frame which encodes a 96 amino acid mature ferredoxin polypeptide preceded by a 52 amino acid transit peptide. Comparison with other plant ferredoxin proteins suggests that Fed A encodes a leaf ferredoxin. Genomic Southern blot analysis indicates the presence of a second, weakly related gene, consistent with other reports of at least two ferredoxins in plants. The Fed A gene promoter contains two regions, ACGCCACGTGGTAGATAGGATT (G-I box) and CCACGCCATTTCCACAAGC (CCAC box), which are strongly conserved in both sequence and position between the Arabidopsis and pea ferredoxin genes. Similarities with other better characterized plant promoter elements are also discussed.

References

  1. Plant Cell. 1989 Jul;1(7):691-698 - PubMed
  2. Plant Cell. 1989 Jul;1(7):681-90 - PubMed
  3. Science. 1986 May 30;232(4754):1106-12 - PubMed
  4. Anal Biochem. 1983 Jul 1;132(1):6-13 - PubMed
  5. Mol Gen Genet. 1989 Jun;217(2-3):240-5 - PubMed
  6. Plant Physiol. 1986 Aug;81(4):1033-8 - PubMed
  7. EMBO J. 1989 Mar;8(3):651-6 - PubMed
  8. J Biochem. 1989 Apr;105(4):619-25 - PubMed
  9. Nucleic Acids Res. 1985 May 10;13(9):3179-94 - PubMed
  10. Biochim Biophys Acta. 1969 Aug 5;180(3):529-35 - PubMed
  11. Nature. 1974 Oct 18;251(5476):614-6 - PubMed
  12. Nucleic Acids Res. 1984 Jan 11;12(1 Pt 1):387-95 - PubMed
  13. Proc Natl Acad Sci U S A. 1989 Sep;86(18):6930-4 - PubMed
  14. Biochim Biophys Acta. 1971 Nov 2;253(1):104-9 - PubMed
  15. EMBO J. 1989 Jun;8(6):1641-8 - PubMed
  16. Bioscience. 1984 Jun;34(6):378-83 - PubMed
  17. EMBO J. 1988 Jul;7(7):1929-36 - PubMed
  18. EMBO J. 1987 Sep;6(9):2543-9 - PubMed
  19. Genes Dev. 1989 Nov;3(11):1745-57 - PubMed
  20. Arch Biochem Biophys. 1987 Aug 1;256(2):430-4 - PubMed
  21. EMBO J. 1988 Dec 20;7(13):4035-44 - PubMed
  22. Proc Natl Acad Sci U S A. 1988 Oct;85(19):7089-93 - PubMed
  23. Genes Dev. 1987 May;1(3):247-55 - PubMed
  24. Mol Cell Biochem. 1976 Feb 25;10(3):161-9 - PubMed

Publication Types